BBa_J100097 1 BBa_J100097 Anhydrotetracycline inducible promoter with BsaI sticky ends 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z Composed regulatory elements of the Tet operon. This promoter sequence contains BsaI sticky ends and is anhydrotetracycline inducible. Additional information about how the sequence was isolated and its regulatory uses can be found in Rolf Lutz and Hermann Bujard's paper, Independent and Tight Regulation of Transcriptional Units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 Regulatory Elements. false false _578_ 0 14739 9 Not in stock false In order to make the promoter 59 bases, we removed all the bases after the start transcription location. false Sarah Kim annotation2182915 1 O2 range2182915 1 1 20 annotation2182916 1 O2 range2182916 1 26 44 annotation2182914 1 -10 range2182914 1 43 48 annotation2182913 1 -33 range2182913 1 20 25 BBa_J100097_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z