BBa_J100098 1 BBa_J100098 Promoter for the argF gene 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z This promoter comes from the genomic sequence of Pseudomonas aeruginosa. This is the promoter for the argF gene found in Pseudomonas aeruginosa. It is an inducible promoter and we are using it to attempt to turn on the rfp gene in Escherichia coli. false false _578_ 0 14606 9 Not in stock false n/a false Erin Nieusma BBa_J100098_sequence 1 ccaagccctccttgtgtttccgcgacatttccttataagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z