BBa_J100099 1 BBa_J100099 A promoter (CydAB) activated by the FNR enzyme 2012-09-12T11:00:00Z 2015-08-31T04:08:22Z Info on FNR: "Activation of FNR-dependent transcription by iron: An in vitro switch for FNR" by Jeffrey Green and John R. Guest. FEMS Microbiology Letters vol. 113 (1993) pp. 219-222 Info on CydAB: "Transcriptional Control Mediated by the ArcA Two-Component Response Regulator Protein of Escherichia coli: Characterization of DNA Binding at Target Promoters" by A. Simon Lynch and Edmund C.C. Lin. Journal of Bacteriology, Nov. 1996, p. 6238???6249 The promoter, CydAB, was found to be activated by the FNR enzyme, which is induced by the presence of (NH4)2Fe(SO4)2 and ascorbate. The oligo includes both CydAB, the FNR binding site, and the sticky ends needed for the Golden Gate Assembly method. false false _578_ 0 14601 9 Not in stock false We had to include the FNR binding site in our oligo. false Phoebe Parrish annotation2182911 1 -35 range2182911 1 29 34 annotation2182791 1 FNR binding range2182791 1 1 22 annotation2182912 1 -10 range2182912 1 53 58 BBa_J100099_sequence 1 ggaattgatatttatcaatgtataagtcttggaaatgggcatcaaaaagagataaattgttctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z