BBa_J100104 1 BBa_J100104 For Testing New Promoters via Golden Gate Assembly v2 2012-12-13T12:00:00Z 2015-08-31T04:08:22Z Built from PCR of J100103 and J100091 on modified version of pSB1A2 that has its BsaI site removed from the Amp^R gene. J100104 was built by Todd Eckdahl and Malcolm Campbell. This part allows users to clone and test new promoters without gel purification or other preparation of DNA - it is ideal for teaching labs. It is a destination vector for Golden Gate Assembly (GGA) using BsaI and Ligase. A new promoter can be derived from synthetic oligos, PCR, or a plasmid clone. The new promoter must be flanked by BsaI sites that produce the 4 nt overhangs required for assembly (see Part:BBa_J119022 as an example, or the picture below). Successful GGA assembly replaces a reporter gene that turns ''E. coli'' blue (J100103) with the new promoter. Upon assembly, a functional new promoter should cause RFP expression. J100104 and its sister part Part:BBa_J100091 incorporate the BD18 bicistronic translational junction (see Part:BBa_J119024) engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. Below is a picture of the portion that pops out when digested with Bsa I. J100103_rev represents the reverse complement of J100103 and is designed to be used for Golden Gate Assembly to swap out the blue protein production for a promoter of your choosing. This can be done by simply mixing J100104 with oligos that self-assemble into dsDNA with compatible sticky ends. J100104 and its sister part Part:BBa_J100091 are ideal for undergraduates in a teaching lab to discover and characterize new promoters for use in synthetic biology. [http://gcat.davidson.edu/mediawiki-1.15.0/index.php/Golden_Gate_Assembly_protocol See the full GGA protocol online.]<br><center> [[Image:J100028.png]] </center> false false _578_ 0 201 61 Not in stock false '''J100104''' contains BBa biobrick prefix + 4 base overhang + BsaI site cutting to the left + reverse complement of blue reporter protein [[Part:BBa_J100103]] + BsaI site that cuts to the right + 4 base overhang + BD18 bicistronic RBS for more reliable translation ([[Part:BBa_J119024]]) + mRFP [[Part:BBa_E1010]] + BBa biobrick suffix. false Malcolm Campbell annotation2213783 1 BsaI cuts left range2213783 1 28 33 annotation2213794 1 P2 reverse range2213794 1 788 833 annotation2213784 1 J100103 rev range2213784 1 34 833 annotation2213787 1 BD18 range2213787 1 845 929 annotation2213790 1 double stop range2213790 1 34 39 annotation2213782 1 right sticky end range2213782 1 23 26 annotation2213786 1 left sticky end range2213786 1 841 844 annotation2213781 1 BBa Prefix range2213781 1 1 22 annotation2213792 1 blue protein range2213792 1 34 702 annotation2213785 1 BsaI cuts right range2213785 1 834 839 annotation2213789 1 double stop range2213789 1 1605 1610 annotation2213788 1 mRFP range2213788 1 930 1610 annotation2213793 1 BD18 reverse range2213793 1 703 787 annotation2213791 1 BBa suffix range2213791 1 1611 1631 BBa_J100104_sequence 1 gaattcgcggccgcttctagagcgactgagaccttattaggcaacaaccggtttacgtgcaatgctaatttcgcactgttcaacgctggtgtaatctttattgtggttggtcacatccagtttacgatccacataatgataaccaggcattttcaccggttttttggctttgtaggtggttttaaactcacacagataatgaccaccaccttccagtttcagtgccataaagttattacccagcagcatgccatcacgtgcaaacagacgttcggtattcggttcccaaccctgggtttttttctgcataaccggaccattaggcggaaaattcagaccgctaaatttcacgtggtagataaagcaattaccctgaatgctgctatcattgctaacggtgcaaactgcaccatcttcaaagttcataatacgttcccaggtataaccttccggaaagctctgtttcacataatccgggatatcttccggatatttggtaaacggaatgctaccatactgacactgcggactcagaatatcccatgcaaacggcagcggaccacctttggtaacggtcagtttaacggtctgttcgccttcatacggtttgcctttaccatcaccttcaacttcaaaataatggccgttcacggtgccgctcatatacactttataggtcatctgctttgcaatcacgctcattagaaacgctccgtcgcatgattaagatgtttcagtacgaaaattgctttcattgttgatctcctttttaagtgaacttgggccctccacacattataggtacaaaaagatgcgaagtcaatactctttttggtctcagcgggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z