BBa_J100110 1 BBa_J100110 P5 promoter cloned into scaffold 2013-06-18T11:00:00Z 2015-08-31T04:08:22Z All parts taken from Registry. P5 promoter (J119031) ligated between junctions A and B on scaffold (J119301). Golden Gate assembly was used to put the promoter into the gap between junctions A and B. iPCR was used to generate the receiving plasmid. false false _578_ 0 18047 9 Not in stock false No internal BsaI sites. false Jessica Gronniger annotation2329791 1 Junction A range2329791 1 1 18 annotation2329797 1 Junction D range2329797 1 99 116 annotation2329794 1 BC spacer range2329794 1 73 76 annotation2329795 1 Junction C range2329795 1 77 94 annotation2329792 1 P5 (J119031) range2329792 1 19 54 annotation2329796 1 CD spacer range2329796 1 95 98 annotation2329793 1 Junction B range2329793 1 55 72 BBa_J100110_sequence 1 atagtctgttcatggtgcttgacaattaatcatccggctcgtaatttatgtggaggctgatgtagttaaggccggatttctaatggggaccatcttagttaagctatgtattcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z