BBa_J100121 1 BBa_J100121 Promoter + Spinach + BsaI sites 2013-07-30T11:00:00Z 2015-08-31T04:08:23Z The sequences were given to us by the Carnegie Mellon University 2012 iGEM team (http://2012.igem.org/Team:Carnegie_Mellon). This part contains a promoter, Spinach, and two BsaI sites with a spacer in between them. Spinach is a fluorogen-activated RNA sequence (biosensor) that binds to DFHBI and fluoresces green when a downstream mRNA sequence is produced. This part can be used with Golden Gate Assembly to determine whether a gene is being transcribed. false false _578_ 0 14601 9 Not in stock false This part was designed using iPCR to amplify the plasmid sent to us by CMU, removing FAP and the RBS. The iPCR primers contained BsaI and PstI sites with spacers in between. The iPCR products were digested using PstI, then ligated together. false Phoebe Parrish, Meredith Simpson, A. Malcolm Campbell annotation2331196 1 T7 promoter range2331196 1 1 19 annotation2331198 1 Spinach range2331198 1 45 245 annotation2331199 1 BsaI site range2331199 1 266 271 annotation2331197 1 BsaI site range2331197 1 246 251 annotation2331201 1 T7 terminator range2331201 1 280 701 annotation2331200 1 PstI site range2331200 1 256 261 BBa_J100121_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagagcccggatagctcagtcggtagagcagcggccgagtaatttacgtcgacgacgcaaccgaatgaaatggtgaaggacgggtccaggtgtggctgcttcggcagtgcagcttgttgagtagagtgtgagctccgtaactggtcgcgtcgacgtcgatggttgcggccgcgggtccagggttcaagtccctgttcgggcgccaggtctccgtactgcagcgtaggtctcggatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatccacaggacgggtgtggtcgccatgatcgcgtagtcgatagtggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatagaaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z