BBa_J100123 1 BBa_J100123 Light inducible promoter 2013-09-11T11:00:00Z 2015-08-31T04:08:23Z M. xanthus This promoter is designed to be inducible by light. We have removed a significant portion of the original sequence in order to meet our specifications. false false _578_ 0 18864 9 Not in stock false Need white light false Dustin Atchley BBa_J100123_sequence 1 gctgaggagatgcccggtggacgctttcacaaaggccgggacctcccgctccggcaatcacaacccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z