BBa_J100125 1 BBa_J100125 This oligo is the promoter sequence for the dnaQ gene. 2013-09-11T11:00:00Z 2015-08-31T04:08:23Z This part is a sequence of nucleotides that functions as a promoter for transcription of a genomic sequence. This promoter can be used in bacterial transformation to decrease the effects of mutagens on the bacteria. false false _578_ 0 18873 9 Not in stock false N/A false Jacqueline Causbie, Grace Harper BBa_J100125_sequence 1 ctgtttaagcatctctggtagacttcctgtaattgaatcgaactgtaaaacgacaagtctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z