BBa_J100126 1 BBa_J100126 pMekA mutated, repressed by glucose 2013-09-11T11:00:00Z 2015-08-31T04:08:23Z http://link.springer.com/content/pdf/10.1007%2Fs00253-013-5030-7.pdf Our version of pMekA is a mutation of pMekA. It is regulated by glucose. false false _578_ 0 18869 9 Not in stock false We had to shorten the pMekA promotor sequence form the front and back by more than 30 nucleotides. This may cause the promoter to lose its normal function. false Joe Zhou BBa_J100126_sequence 1 caccggattcttcaaaccattcaccatttccttcaagcgtgaaacttgccctcattgttaccgttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z