BBa_J100128 1 BBa_J100128 P1 Promoter 2013-09-11T11:00:00Z 2015-08-31T04:08:23Z This part comes from the LEE20_275 gene sequence. This is the oligo including the sticky ends of a shortened P1 promoter (which is constitutive), so we can see if this shortened version of the Promoter still works. false false _578_ 0 18871 9 Not in stock false We had to determine which segments of this sequence are highly conserved and insure that these were not cut out when we shortened the sequence to determine if a shortened version of the promoter would still work. false Frances Adams BBa_J100128_sequence 1 ttttgttgacatttaatgataatgtattttacacattaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z