BBa_J100130 1 BBa_J100130 Zur Box: XC0267 2013-09-11T11:00:00Z 2015-08-31T04:08:23Z This source comes from the genomic sequence of bacteria, namely Xanthomonas campestris. Bacterial cells rely on Zinc as a trace element, however a large Zinc presence can be detrimental if it forms specific compounds within the cell. Bacterial cells have to regulate the amount of Zn2+. To maintain zinc homeostasis, bacteria can use Zur in order to keep the appropriate levels of Zn2+, since the Zur promoter represses the transcription of Zn2+. The Zurr box acts as a repressor for Zn2+ uptake and houses several promoter regions (Don Liang-Huang 2008: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2490734/) false false _578_ 0 18853 9 Not in stock false In order to induce the promoter, .5 micromoles of zinc sulfate must be added to the Zurr box. false Bruna Siqueira BBa_J100130_sequence 1 ggcgagttgttatacagtaacatttctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z