BBa_J100131 1 BBa_J100131 human IL-6 2013-09-22T11:00:00Z 2015-08-31T04:08:23Z came from GenBank and then was modified. Human IL-6 CDS optimized for E. coli with no internal restriction sites for EcoRI, XbaI, SpeI, PstI or BsaI. This insert was synthesized by GeneArt and was cloned into their pMK-T plasmid so we had the BioBrick prefix and suffix included in the basic part sequence. It will be used with Golden Gate Assembly to put downstream of promoter+RBS. false false _578_ 0 201 61 Not in stock false Internal restriction sites removed for EcoRI, XbaI, SpeI, PstI or BsaI. This insert was synthesized by GeneArt and was cloned into their pMK-T plasmid so we had the BioBrick prefix and suffix included in the basic part sequence. It will be used with Golden Gate Assembly to put downstream of promoter+RBS. false Malcolm Campbell annotation2359023 1 start codon range2359023 1 34 36 annotation2359021 1 Prefix range2359021 1 1 22 annotation2359022 1 Suffix range2359022 1 603 623 annotation2359459 1 BsaI cuts left range2359459 1 597 602 annotation2359024 1 stop codon range2359024 1 589 591 annotation2359457 1 BsaI cuts right range2359457 1 23 28 annotation2359458 1 sticky end range2359458 1 30 33 annotation2359025 1 Human IL-6 range2359025 1 34 591 annotation2359460 1 sticky end range2359460 1 592 595 BBa_J100131_sequence 1 gaattcgcggccgcttctagagggtctcagcgaatgccggttccgcctggtgaagatagcaaagatgttgcagcatttcatcgtcagccgctgaccagcagcgaacgtattgataaacaaattcgctatatcctggatggcattagcgcactgcgtaaagaaacctgtaataaaagcaatatgtgcgaaagcagcaaagaagcactggcagaaaataatctgaatctgccgaaaatggccgaaaaagatggttgttttcagagcggctttaatgaagaaacctgcctggttaaaatcattaccggtctgctggaatttgaggtgtatctggaatatctgcaaaaccgttttgaaagcagcgaagaacaggcacgtgcagttcagatgagcaccaaagttctgattcagtttctgcaaaaaaaagccaaaaacctggatgcaattaccacaccggatccgaccaccaatgcaagcctgctgaccaaactgcaagcacagaatcagtggctgcaagatatgaccacccatctgattctgcgtagctttaaagaatttctgcaaagcagcctgcgtgcactgcgtcagatgtaagcctagagacctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z