BBa_J100132 1 BBa_J100132 E. coli thyA 2013-09-22T11:00:00Z 2015-08-31T04:08:23Z Based on the cells used in this paper by Thompson et al., 2002. [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC139998/ Thompson et al., 2002] This is the E. coli thyA gene that converts dUMP to dTMP. Cells lacking this gene (C600thyA::KanR) need this cell to be prototrophic. false false _578_ 0 201 61 Not in stock false We added BioBrick prefix and suffix since the gene was synthesized by GeneArt and cloned into their pMK-T plasmid. There are no internal EcoRI, XbaI, SpeI, PstI, or BsaI restriction sites. false Malcolm Campbell annotation2359043 1 sticky end range2359043 1 829 832 annotation2359041 1 sticky end range2359041 1 30 33 annotation2359038 1 Suffix range2359038 1 840 860 annotation2359042 1 BsaI cuts left range2359042 1 834 839 annotation2359046 1 tyA gene range2359046 1 35 828 annotation2359045 1 stop codon range2359045 1 826 828 annotation2359037 1 Prefix range2359037 1 1 22 annotation2359044 1 start codon range2359044 1 34 36 annotation2359039 1 BsaI cuts right range2359039 1 23 28 BBa_J100132_sequence 1 gaattcgcggccgcttctagagggtctcagcgaatgaaacagtatttagaactgatgcaaaaagtgctcgacgaaggcacacagaaaaacgaccgtaccggaaccggaacgctttccatttttggtcatcagatgcgttttaacctgcaagatggattcccgctggtgacaactaaacgttgccacctgcgttccatcatccatgaactgctgtggtttctacagggcgacactaacattgcttatctacacgaaaacaatgtcaccatctgggacgaatgggccgatgaaaacggcgacctcgggccagtgtatggtaaacagtggcgcgcctggccaacgccagatggtcgtcatattgaccagatcactacggtactgaaccagctgaaaaacgacccggattcgcgccgcattattgtttcagcgtggaacgtaggcgaactggataaaatggcgctggcaccgtgccatgcattcttccagttctatgtggcagacggcaaactctcttgccagctttatcagcgctcctgtgacgtcttcctcggcctgccgttcaacattgccagctacgcgttattggtgcatatgatggcgcagcagtgcgatctggaagtgggtgattttgtctggaccggtggcgacacgcatctgtacagcaaccatatggatcaaactcatctgcaattaagccgcgaaccgcgtccgctgccgaagttgattatcaaacgtaaacccgaatccatcttcgactaccgtttcgaagactttgagattgaaggctacgatccgcatccgggcattaaagcgccggtggctatctaagcctagagacctactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z