BBa_J100173 1 BBa_J100173 Designed to optimize testing of fitness genes 2014-07-23T11:00:00Z 2015-08-31T04:08:23Z E. coli genome This construct is meant to be inserted into a plasmid backbone (stringent plasmid recommended). It is a theophylline riboswitch (D) and contains BsaI sites. After digesting with BsaI a fitness gene with the appropriately designed sticky ends can be inserted and tested. false false _578_ 0 18864 9 Not in stock false NA false Dustin Atchley annotation2380303 1 T5 promoter range2380303 1 7 58 annotation2380313 1 PstI range2380313 1 240 245 annotation2380307 1 START range2380307 1 167 169 annotation2380311 1 LVA Degradation Tag range2380311 1 204 236 annotation2380312 1 STOP range2380312 1 237 239 annotation2380304 1 Lac operator range2380304 1 59 78 annotation2380308 1 BsaI <-- range2380308 1 171 176 annotation2380306 1 aptamer and actuator of riboswitch range2380306 1 109 169 annotation2380302 1 J100065 (theophylline riboswitch D) range2380302 1 7 169 annotation2380305 1 linkers and scars range2380305 1 79 108 annotation2380301 1 EcoRI range2380301 1 1 6 annotation2380310 1 BsaI --> range2380310 1 197 202 annotation2380309 1 stuffer range2380309 1 178 196 BBa_J100173_sequence 1 gaattcgaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgtgagaccgccagctttacggtctttatggtctctgctgcaaacgacgaaaactacgctttagtagcttaactgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z