BBa_J100175 1 BBa_J100175 aspA promoter 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z E. Coli K-12 Genome Source: RegulonDB (version 8.0): Omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more. Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Mu??iz-Rascado L, Garc??a-Sotelo JS, Weiss V, Solano-Lira H, Mart??nez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hern??ndez S, Alquicira-Hern??ndez K, L??pez-Fuentes A, Porr??n-Sotelo L, Huerta AM, Bonavides-Mart??nez C, Balderas-Mart??nez YI, Pannier L, Olvera M, Labastida A, Jim??nez-Jacinto V, Vega-Alvarado L, Del Moral-Ch??vez V, Hern??ndez-Alvarez A, Morett E, Collado-Vides J. Nucleic Acids Research 2012 Nov; doi: 10.1093/nar/gks1201 Promoter for the aspA-dcuA operon. The aspA gene codes for the enzyme aspartoacylase, which is essential to the production of white matter in the brain. This enzyme breaks down N-acetyl-L-Aspartic Acid into separate aspartic acid and acetic acid. The promoter is repressible when nitrate is added and the protein NarL can bind at the repressor sites -60 and -115. Because we cut down the length of the promoter to only 54 base pairs in length, the protein binding sites to repress the promoter have been removed. NarL will be unable to bind and repress the promoter. false false _578_ 0 23994 9 Not in stock false We had to consider that the binding sites of the protein NarL would be removed when cutting down the promoter, which most likely means that the promoter will never be turned off. false Anna Merritt annotation2382860 1 -35 range2382860 1 22 28 annotation2382861 1 -10 range2382861 1 48 53 BBa_J100175_sequence 1 cgacacttaaagtgatccagattacggtagaaatcctcaagcagcatatgatctcggggcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z