BBa_J100176 1 BBa_J100176 FabHAF promoter 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z Bacillus subtilis FapR is a bacterial transcription factor from Bacillus subtilis that regulates gene expression related to fatty acids and phospholipid metabolism. It can be used for sensing the fatty acid biosynthesis status and adjusting fap regulon expression. Source: Schujman, Gustavo E., Luciana Paoletti, Alan D. Grossman, and Diego De Mendoza. "FapR, a Bacterial Transcription Factor Involved in Global Regulation of Membrane Lipid Biosynthesis." Developmental Cell (2003): 663-72. National Center for Biotechnology Information. Web. 11 Sept. 2014. <http://www.ncbi.nlm.nih.gov/pubmed/12737802>. false false _578_ 0 23986 9 Not in stock false There are no internal BsaI sites and the RNA start positions are -10 and -35. false Jenny Fritz annotation2391911 1 -35 range2391911 1 16 21 annotation2391910 1 -10 range2391910 1 34 39 BBa_J100176_sequence 1 cgacagacgaatatattgccatgtgaaaaaaaataggatagaattagtagcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z