BBa_J100179 1 BBa_J100179 modF promoter for E. coli 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z http://www.karger.com/Article/FullText/354311 This promoter is found in parts in over 33 genes within E. coli. These genes contain the identifiers TATCCC () GGATA, with the () containing any number of base pairs, dependent on which gene the promoter codes for. We chose to use the () specific to the modF gene and test its effects on the pClone red gene within E. coli. This promoter is repressible. When hipB binds to the promoter region, the promoter is shut off. false false _578_ 0 23976 9 Not in stock false We added 1 base pair of G prior to the 3' to 5' sticky end so that the designated number of base pairs between the promoter and transcription initiation site would be met, as 5 were necessary and we only had 4 with the sticky ends. false Rosalind Major annotation2391912 1 -10 range2391912 1 35 39 annotation2391908 1 -35 range2391908 1 5 9 BBa_J100179_sequence 1 cgactatccctgtcagtaatcgctgcacaaagtgggataggcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z