BBa_J100180 1 BBa_J100180 P2(2) promoter 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z The P2(2) promoter comes from the AS-48 gene cluster. The P2(2) promoter is a constitutive promoter which can incorporated into a plasmid for bacterial transformation. We found this promoter from an article testing the fluorescence of mCherry titled "Analysis of the Promoters Involved in Enterocin AS-48 Expression" by Ruben Cebrian, et. al published by Departamento de Microbiologia, Facultad de Ciencias, Universidad de Granada, Spain. false false _578_ 0 23983 9 Not in stock false The article shows the promoter can be affected by pH ranges 6.0-8.0 with pH 8.0 resulting in greatest fluorescence. false Anna Buser, Jerry Chang, Natalie Philips, Ali Kamal annotation2382864 1 -10 range2382864 1 39 44 annotation2382863 1 -35 range2382863 1 11 16 BBa_J100180_sequence 1 cgactattacttcactattttttttgttttcaaatattttaattgctgagcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z