BBa_J100182 1 BBa_J100182 nifB promoter 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z the nifB is located in the nif gene cluster, upstream of nifH, nifD, nifK, nifE, nifN, nifX.... The nifB promoter comes from the Paenibacillus that lives in bamboo. The promoter is always turned on until repressed by the presence of nitrogen. The gene is involved in nitrogen fixation. false false _578_ 0 23985 9 Not in stock false confining that the nifB promoter did have the -10/-35 false Evelyn Morris annotation2382877 1 -35 range2382877 1 16 21 annotation2382876 1 -10 range2382876 1 39 44 BBa_J100182_sequence 1 cgacggagaagtgaattgactgtatttgtccctgtctctaagatgtaattatatcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z