BBa_J100183 1 JEAN P R/tetO 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z The genomic sequence comes from rhizobial phage 16-3. This is a hybrid promoter that was engineered from a P R promote from rhizobial phage 16-3, along with its companion hybrid P R/tetO. It was engineered to be inducible by p-isopropyl benzoate (cumate)(Q) or anhydrotetracycline (aTc). P R/cmtO was observed to respond to a range of 0.1 to 5 ??g/ml (0.6 to 30 ??M) of Q and the P R/tetO promoter from 0.1 to 25 ng/ml (0.2 nM to 50 nM) aTc. This promoter was designed for use in Methylobacterium extorquens. http://www.biomedcentral.com/1756-0500/6/183 "A novel pair of inducible expression vectors for use in Methylobacterium extorquens." false false _578_ 0 23984 9 Not in stock false We designed the sticky ends to be inducible with BsaI. false Erin Xu, Nick Elder, Julia Preziosi, Abby Hunt annotation2382878 1 -10 range2382878 1 42 47 annotation2382879 1 -35 range2382879 1 22 27 BBa_J100183_sequence 1 cgacaaggcaaacaatggtacttgacgactcatcacaacaattgtagttgtagattgtaagcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z