BBa_J100184 1 BBa_J100184 Heat Induced Promoter on rpoD gene 2014-09-10T11:00:00Z 2015-08-31T04:08:23Z E. coli The Phs promoter on the rpoD gene allows the gene to still function under high heat. The rpoD gene codes for the sigma subunit of E. coli RNA polymerase. The Phs promoter functions ideally at 43 degrees Celsius. Taylor, et. al. (1984) Cell v. 38 p. 371-381 false false _578_ 0 24006 9 Not in stock false The promoter functions ideally when placed for 3-10 minutes at 43 degrees Celsius. No Bsa I sites. false Kevin Endersby annotation2382881 1 -10 range2382881 1 40 45 annotation2382880 1 -35 range2382880 1 17 22 BBa_J100184_sequence 1 cgacatgctgccacccttgaaaaactgtcgatgtgggacgatatagcagatagcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z