BBa_J100199 1 BBa_J100199 Fitness Gene Tester + LVA degradation tag 2014-09-14T11:00:00Z 2015-08-31T04:08:23Z N/A We designed a fitness gene tester that allows for easy ligation of a fitness gene downstream of a theophylline riboswitch. Easy ligation is facilitated by the BsaI sites separated by a spacer sequence. The chosen fitness gene inserted into the fitness gene tester will include an LVA degradation tag that will reduce the half life of the fitness gene being tested. false false _578_ 0 18881 9 Not in stock true The fitness gene tester includes an internal BsI site and an LVA degradation tag. false Telavive Taye annotation2383845 1 Theophylline RiboswitchD range2383845 1 59 164 annotation2383843 1 EcorI site range2383843 1 1 6 annotation2383844 1 T5 Promoter range2383844 1 7 58 annotation2383846 1 start codon range2383846 1 165 167 annotation2383853 1 PstI site range2383853 1 240 245 annotation2383849 1 spacer range2383849 1 177 197 annotation2383850 1 BsaI site range2383850 1 197 202 annotation2383847 1 BsaI site range2383847 1 171 176 annotation2383852 1 Stop codon range2383852 1 237 239 annotation2383851 1 LVA d??gradation tag range2383851 1 204 236 BBa_J100199_sequence 1 gaattcgaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagatacgactcactataggtaccggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggtaacaacaagatgtgagaccgccagctttacggtctttatggtctctgctgcaaacgacgaaaactacgctttagtagcttaactgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z