BBa_J100228 1 BBa_J100228 rpoD IPTG induced bacterial promoter 2015-09-09T11:00:00Z 2015-09-10T08:06:09Z this promoter is found in phytoplasmas which are insect-transmissible and plant-pathogenic bacteria hat multiply intracellularly in plants and insects. Chihiro Miura et.al. Functional characterization of the principal sigma factor rpoD of phytoplasmas via an in vitro transcription assay this promoter is found in phytoplasmas which are insect-transmissible and plant-pathogenic bacteria hat multiply intracellularly in plants and insects. Chihiro Miura et.al.s via an in vitro transcription assay This promoter is induced by 0.1 mM concentration of IPTG and binds with bacterial DNA. The -10 region is TATAAT and the -35 region is TTGCTA. false false _578_ 28823 28823 9 false sticky ends were added to the strand which were CGAC on the left and CGCC on the right false Sarah von Euler annotation2448573 1 -10 range2448573 1 44 49 annotation2448575 1 -35 range2448575 1 21 26 BBa_J100228_sequence 1 aaaaaaaagcaacaaaacatttgctatttgtttttttatgtgatataataaaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z