BBa_J100229 1 BBa_J100229 ddlR gene promoter 2015-09-09T11:00:00Z 2015-09-10T08:18:25Z A New Member of MocR/GabR-type PLP-Binding Regulator of D-Alanyl-D-Alanine Ligase in Brevibacillus brevis Authors: Takashi Takenaka1, Tomokazu Ito1*, Ikuko Miyahara2, Hisashi Hemmi1, Tohru Yoshimura1 Based on past research, the ddlR gene promoter requires the DdlR protein to function. We're testing the hypothesis that the ddlR promoter is constitutive. false false _578_ 28800 28800 9 false Altered fifth base in -35 region from A to C. Altered second base in -10 region from T to A. false Hannah Doyle annotation2448587 1 -35 box range2448587 1 24 29 annotation2448586 1 -10 box range2448586 1 51 56 BBa_J100229_sequence 1 tacgaaagaggaaccaccgaaggatgacaaatccagtacggtggttcttttattatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z