BBa_J100230 1 BBa_J100230 HFQp:Cold-induced promoter 2015-09-09T11:00:00Z 2015-09-10T08:07:14Z It comes from an experiment done with multiple different promoters. HFQ protein. This promoter is cold-induced and it works between 4 and 20 degrees celsius. We will be putting this promoter sequence in a plasmid of E. coli to see if it expresses red fluorescent protein (RFP). false false _578_ 28820 28820 9 false We had to add specific sticky ends for the BSA1 recognition sequence. false Shayna Moss annotation2448572 1 -10 box range2448572 1 37 42 annotation2448574 1 -35 box range2448574 1 9 14 BBa_J100230_sequence 1 aaagaataaagttttctagtattagaattactattgatattacataaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z