BBa_J100231 1 BBa_J100231 tolC Constitutive Promoter in E. coli 2015-09-09T11:00:00Z 2015-09-10T08:16:30Z The part comes from a promoter for the tolC gene that encodes a major outer membrane protein in E. Coli. This promoter sequence is 60 base paris long. The original sequence was 58 base pairs long without the sticky ends, so we shortened the sequence to 56 base pairs (taking 2 base pairs off from the 5' end) and we added the appropriate sticky ends to each side. The -10 sequence is TTAAAT and the -35 sequence is TTGACT. it is believed to be a constitutive promoter. We will be using it to promote RFP expression in E. coli. We are experimenting with the p1 promoter to tolC (which is constitutive) rather than the p2 promoter for tolC, which requires chemicals to be activated. false false _578_ 28821 28821 9 false We considered modifying the -10 sequence to match the consensus sequence of E. coli because of the strongly negative score from the position weight matrix that our sequence scored. We decided to keep our original sequence and not modify it to test the effectiveness of the original promoter. There was no position weight matrix available to compare with the -35 sequence. false Kelly Friers annotation2448585 1 -35 Box range2448585 1 14 19 annotation2448582 1 -10 Box range2448582 1 40 45 BBa_J100231_sequence 1 atttcagcgacgtttgactgccgtttgagcagtcatgtgttaaattgaggcacatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z