BBa_J100233 1 BBa_J100233 gapA promoter - predicted constitutive on 2015-09-09T11:00:00Z 2015-09-10T01:57:16Z This part comes from the gene promoter for gapA. We found the discussion of the gapA gene in the lab report, "A Constitutive Expression System for Cellulase Secretion in Escherichia coli and Its Use in Bioethanol Production." The lab determined which gene promoter would express cellulase the most efficiently. The gapA promoter worked well because it was constitutive. In looking for the gene promoter sequence of gapA, we came across another article entitled "The Escherichiacoli gapA Gene Is Transcribed by the Vegetative RNA Polymerase Holoenzyme Eur70 and by the Heat Shock RNA Polymerase Eu32. This article gave us the sequence of gapA gene promoter and included all of the -10 sequences and -35 sequences for the gapA gene. Our oligos is only a portion of the gene promoter false false _578_ 28828 28828 9 false We took 56 nucleotides starting closest to the gapA p1 gene origin. false Anna Catalanotto annotation2448783 1 -35 box range2448783 1 21 26 annotation2448782 1 -10 box range2448782 1 43 48 BBa_J100233_sequence 1 caatgattgacacgattcgcttgacgctgcgtaaggtttttgtaattttacaggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z