BBa_J100234 1 BBa_J100234 color regulatory gene induced by ATc 2015-09-09T11:00:00Z 2015-09-10T12:48:42Z synthetic Concentration of 100 ng/mL of ATc induces transcription of this gene. false false _578_ 28836 28836 9 false sticky ends false Taylor Burey BBa_J100234_sequence 1 tttatattttcataaaaatccctatcagtgatagagaatttttgatataataccttatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z