BBa_J100235 1 BBa_J100235 Arabinose induced araBAD 2015-09-09T11:00:00Z 2015-09-10T01:19:41Z Sourced from the araBAD gene. Contains base pairs located -56 to -1 from the transcription site. This is a inducible bacterial promotor that function in the presence of a arabinose. It enables a bacterium to metabolize arabinose as an alternative energy source to glucose. false false _578_ 28812 28812 9 false This promotor was restricted to 60 base pairs due to size constraints on oligo construction. false Hartlee Johnston annotation2448780 1 -10 box range2448780 1 41 47 annotation2448781 1 -35 box range2448781 1 19 25 BBa_J100235_sequence 1 aagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z