BBa_J100242 1 BBa_J100242 mdtG Promotor in the Marbox Regulon Induced by Paraquat/Asprin 2016-01-28T12:00:00Z 2016-01-28T09:13:48Z The source for this sequence is a study conducted by F??brega et. al. called "Constitutive SoxS Expression in a Fluoroquinolone-Resistant Strain with a Truncated SoxR Protein and Identification of a New Member of the marA-soxS-rob Regulon, mdtG" This is a promotor that is induced by exposure to either paraquat or sodium salicylate. It specifically lies in the SoxRS region, and upon activation, it intern activates genes including the marA-soxS-rob regulon. false false _578_ 29249 29249 9 No part sequence false None false Logan Russell annotation2478454 1 -35 range2478454 1 29 34 annotation2478455 1 -10 range2478455 1 52 57 annotation2478457 1 Sticky End range2478457 1 1 4 BBa_J100242_sequence 1 cgacatttagcgataaaagctctctggattgcgccccctggaagtcgggcgcataatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z