BBa_J100243 1 BBa_J100243 yebG gene 2016-01-28T12:00:00Z 2016-01-28T08:50:07Z Identification of yebG gene as a DNA damage-inducible Escherichia coli gene (Lamba) The yebG gene is a novel SOS regulon gene. It controls transcription in a recA-, lexA-dependent way and that the reporter gene expression is inducible by DNA damage consequent to mitomycin C treatment. The yebG product is predicted to be a 96 amino acid residue, 10.7 kDa protein. false false _578_ 29255 29255 9 false None. false Tanner Carlson annotation2478448 1 Ribosome Binding Site range2478448 1 48 53 annotation2478447 1 -35 range2478447 1 6 11 annotation2478446 1 -10 range2478446 1 30 35 annotation2478451 1 SOS Box range2478451 1 23 42 BBa_J100243_sequence 1 atttctcaaccgaaaagaaatatactgtataaaatcacagttattatgagaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z