BBa_J100247 1 BBa_J100247 nirB Promoter Sequence 2016-01-28T12:00:00Z 2016-01-28T02:39:50Z The sequence comes from the nirB gene found in E.coli and expressed during anaerobic growth. This sequence acts an inducible promoter, induced by nitrate and nitrite. It is derived from the nirB gene, which has been used to detect the presence of nitrites and nitrates in anaerobic conditions. false false _578_ 29265 29265 9 false The original sequence was 93 bases long, so it has been reduced by 39 bases in order to fit the perimeters of our experiment. false Anna Ferdinand BBa_J100247_sequence 1 cgactatataaaggtgaatttgatttacatcaataagttgctgaatcgttaaggtcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z