BBa_J100248 1 BBa_J100248 Stress regulation promoter 2016-01-28T12:00:00Z 2016-01-28T03:34:20Z Boulanger, A., Francez-Charlot, A., Conter, A., Castani??-Cornet, M.-P., Cam, K., & Gutierrez, C. (2005). Multistress Regulation in Escherichia coli: Expression of osmB Involves Two Independent Promoters Responding either to σS or to the RcsCDB His-Asp Phosphorelay. Journal of Bacteriology, 187(9), 3282???3286. http://doi.org/10.1128/JB.187.9.3282-3286.2005 To adapt to adverse conditions, bacterial cells induce specific families of genes that promote growth or survival in stressful environments. Many such genes can be induced by a variety of stresses through several transcriptional regulators acting on one or several stress-inducible promoters. In Escherichia coli, osmB is an example of a multistress-responsive gene, and it is expressed by two promoters. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a sigma(S)-dependent manner. false false _578_ 29293 29293 9 false We have to consider where cleaving the sequence would be appropriate while considering the incorporation of the transcription site and the consensus sequences. Additionally, we had to understand how we would go about conducting the osmotic shock to induce the promoter. false Maxwell Evans annotation2478465 1 osmBp2 range2478465 1 37 56 annotation2478463 1 -35 range2478463 1 1 6 annotation2478464 1 -10 range2478464 1 22 28 BBa_J100248_sequence 1 ttcaccagacttattcttagctattatagttatagagagcttacttccgtgaatca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z