BBa_J100250 1 BBa_J100250 trp promotor lab 2016-01-28T12:00:00Z 2016-02-11T02:56:37Z http://www.ncbi.nlm.nih.gov/pubmed/11252809 where we found the TRP promoter and the -35 to -10 sequence http://www.hammiverse.com/lectures/18/4.html details of the negative loop mechanism We are inserting the TRP promoter into E. coli and monitoring the natural production of tryptophan. TRP is a repressible promoter which causes a negative feedback mechanism--the continued production of tryptophan with inhibit the TRP promoter which will then cut off the further production of tryptophan. We will observe the maximum threshold of the E. coli bacteria before the tryptophan levels increase enough to inhibit the TRP promoter. false false _578_ 29291 29291 9 false We had to take into consideration the natural production of tryptophan by the promoter which acts as a repressor when there are high concentrations of tryptophan. false Jeffrey Burton BBa_J100250_sequence 1 cgacctgttgacaattaatcatcgaactagttaactagtacgcaagtgacaactgttaattagtagcttgatcaattgatcatgcgttcacgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z