BBa_J100263 1 BBa_J100263 RS10 (Wachsmuth et al. 2013) in J119361 2016-06-08T11:00:00Z 2016-06-13T08:03:20Z The RS10 riboswitch was developed by Wachsumth et al. for their 2013 paper "De novo design of a synthetic riboswitch that regulates transcription termination." The RS10 riboswitch was inserted into J119361 via Golden Gate Assembly and replaced the GFP cassette that had occupied this part. J11263 reports the functionality of the RS10 riboswitch from Wachsumth et al. 2013 by its expression of the reporter RFP gene. The RS10 riboswitch is a theophylline-binding transcriptional riboswitch that turns on gene expression in the presence of theophylline. In the presence of theophylline, cells containing this part should fluoresce red. In the absence of theophylline, cells containing this part should not fluoresce. false false _578_ 28825 28825 9 false The design of this sequence required the insertion of the RS10 riboswitch upstream of the reporter RFP gene. Such a design was made possible by the replacement of the GFP cassette in J119361 with the RS10 riboswitch via Golden Gate Assembly. false Owen Koucky annotation2480085 1 BD18 C Dog RBS range2480085 1 113 197 annotation2480084 1 RS10 range2480084 1 41 108 annotation2480086 1 RFP protein half range2480086 1 198 878 annotation2480083 1 P5 promoter range2480083 1 1 36 BBa_J100263_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggacgacaagtgataccagcatcgtcttgatgcccttggcagcacttcagaaatctctgaagtgctgttttttttgcgggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z