BBa_J100272 1 BBa_J100272 rClone Red Version 2: Device for GGA Cloning and Testing RBS elements and Riboswitches 2016-06-20T11:00:00Z 2016-06-21T01:17:58Z / rClone Red Version 2 (V2) allows users to clone and test new RBS elements and riboswitches without gel purification or other preparation of DNA. It is a destination vector for Golden Gate Assembly (GGA) using BsaI and ligase. A new RBS or riboswitch can be derived from synthetic oligos, PCR, or a plasmid clone. For proper assembly, the new insert must have the appropriate 4 nt sticky ends or be flanked by BsaI sites that produce the sticky ends. With reference to the top strand, the left site must be 5' CGAC 3' and the right site must be 5' GCGG 3'. BsaI always produces a 5' overhang sticky end. Successful GGA assembly replaces the reverse promoter driving GFP expression with the new RBS or riboswitch. Transcription will be initiated in the direction of the RFP coding sequence. The level of expression of RFP will depend on the efficiency of the newly cloned RBS or riboswitch. false false _578_ 201 201 61 false When designing oligonucleotides for use with rClone Red V2, make sure they result in 5' overhang sticky ends that are CGAC (left) and GCGG (right). Also make sure the oligonucleotides do not contain binding sites for BsaI. Finally, make sure the RBS element ends immediately before the GCGG right sticky end. This will ensure a spacing of 6 bases between the RBS and the ATG start codon of RFP. Below is an example. false Malcolm Campbell annotation2480267 1 GFP range2480267 1 55 775 annotation2480265 1 P5 Promoter range2480265 1 1 37 annotation2480269 1 P2 Promoter range2480269 1 803 849 annotation2480271 1 Optimized E1010 RFP range2480271 1 862 1542 annotation2480270 1 BsaI Site range2480270 1 849 855 annotation2480268 1 RBS B0034 range2480268 1 781 793 annotation2480266 1 BsaI Site range2480266 1 42 48 BBa_J100272_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggacgactgagaccactagagttattatttgtatagttcatccatgccatgtgtaatcccagcagctgttacaaactcaagaaggaccatgtgatctctcttttcgttgggatctttcgaaagggcagattgtgtggacaggtaatggttgtctggtaaaaggacagggccatcgccaattggagtattttgttgataatggtctgctagttgaacgcttccatcttcaatgttgtgtctaattttgaagttaactttgattccattcttttgtttgtctgccatgatgtatacattgtgtgagttatagttgtattccaatttgtgtccaagaatgtttccatcttctttaaaatcaataccttttaactcgattctattaacaagggtatcaccttcaaacttgacttcagcacgtgtcttgtagttcccgtcatctttgaaaaatatagttctttcctgtacataaccttcgggcatggcactcttgaaaaagtcatgctgtttcatatgatctgggtatctcgcaaagcattgaacaccataaccgaaagtagtgacaagtgttggccatggaacaggtagttttccagtagtgcaaataaatttaagggtaagttttccgtatgttgcatcaccttcaccctctccactgacagaaaatttgtgcccattaacatcaccatctaattcaacaagaattgggacaactccagtgaaaagttcttctcctttacgcatctagtatttctcctctttaattactagatccacacattataggtacaaaaagatgcgaagtcaatactctttttggtctctgcggagatggcgtcaagtgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z