BBa_J100283 1 BBa_J100283 rClone Red with RBS: Device for GGA Cloning and Testing RBS elements and Riboswitches 2016-06-27T11:00:00Z 2016-06-29T03:22:52Z rClone Red allows users to clone and test new RBS elements and riboswitches without gel purification or other preparation of DNA. It is a destination vector for Golden Gate Assembly (GGA) using BsaI and ligase. A new RBS or riboswitch can be derived from synthetic oligos, PCR, or a plasmid clone. For proper assembly, the new insert must have the appropriate 4 nt sticky ends or be flanked by BsaI sites that produce the sticky ends. With reference to the top strand, the left site must be 5' CGAC 3' and the right site must be 5' GCGG 3'. BsaI always produces a 5' overhang sticky end. Successful GGA assembly replaces the reverse promoter driving GFP expression with the new RBS or riboswitch. Transcription will be initiated in the direction of the RFP coding sequence. The level of expression of RFP will depend on the efficiency of the newly cloned RBS or riboswitch. <center> [[File:RClone_Red.png]] </center> false false _578_ 201 33021 9 false When designing oligonucleotides for use with rClone Red, make sure they result in 5' overhang sticky ends that are CGAC (left) and GCGG (right). Also make sure the oligonucleotides do not contain binding sites for BsaI. Finally, make sure the RBS element ends immediately before the GCGG right sticky end. This will ensure a spacing of 6 bases between the RBS and the ATG start codon of RFP. Below is an example. <center> [[File:Oligos_for_rClone_Red.png]] </center> false Rachel Neal annotation2480804 1 RBS range2480804 1 41 51 annotation2480805 1 RFP range2480805 1 58 738 annotation2480811 1 sticky end range2480811 1 52 55 annotation2480809 1 P5 range2480809 1 1 36 annotation2480810 1 sticky end range2480810 1 37 40 BBa_J100283_sequence 1 ttgacaattaatcatccggctcgtaatttatgtggacgacagaggggaggggcggagatggcttcctccgaagatgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagatggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagatggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagattacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z