BBa_J100299 1 BBa_J100299 lysine regulated promoter 2016-09-07T11:00:00Z 2016-09-08T08:11:24Z This sequence is from E. coli. Bouvier, J., P. Strangler, V. Morales, E. Remy, and C. Gutierrez. "Lysine Represses Transcription of the E. Coli DapB Gene by Preventing Its Activation by the ArgP Activator." Journal of Bacteriology, Aug. 2008. p. 5224-5229. This promoter includes the -91 to -81 regions directly upstream of the -35 to 0 region in addition to the sticky ends for BsaI. Top1- 5' CGACTTTCACTGATATGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACG Bot1- 5' CGCCCGTTTTCAGAGTAACCAGCGCATCGCTACGCCGCCATATCAGTGAAA The -81 to -118 region is known to be a binding sight for lysine repression of the promoter (Bouvier, Jean, et. al 2008). If this whole region is not needed for lysine binding and the lysine will still bind if the binding sight is located directly upstream of the -35 region, the promoter should be activated in the absence of lysine and repressed in the presence of lysine. false false _578_ 33842 33842 9 false See description. false Lydia Soifer annotation2482658 1 -35 box range2482658 1 12 17 annotation2482657 1 -10 box range2482657 1 35 40 annotation2482659 1 lysine repression site range2482659 1 1 11 BBa_J100299_sequence 1 tttcactgatatggcggcgtagcgatgcgctggttactctgaaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z