BBa_J100300 1 BBa_J100300 PprpB 2016-09-07T11:00:00Z 2016-09-08T08:00:01Z This promoter originates from Escherichia coli. Reference: "2-Methylcitrate-dependent activation of the propionate catabolic operon (prpBCDE) of Salmonella enterica by the PrpR protein" Microbiology Volume 150, pages 3877 - 3887 (2004). Palacios and Escalante-Semerena A promoter that regulates the gene prpBCDE, which regulates expression of the propionate catabolic genes. false false _578_ 33932 33932 9 false We chose the first 50 bases. false Jose David Hernandez annotation2482655 1 -10 box range2482655 1 35 41 annotation2482656 1 -35 box range2482656 1 10 16 BBa_J100300_sequence 1 tgctttgtctttatcaacgcaaataacaagttgataacaaaggatgggct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z