BBa_J100303 1 BBa_J100303 PmanP 2016-09-07T11:00:00Z 2016-09-08T01:31:49Z Bacillus subtilis Sun, Tianqi; Altenbuchner, Josef. ???Charaterization of a Mannose Utilization System in Bacillus subtilis.??? Journal of Bacteriology, vol. 192, No. 8, 2010, pp. 2128-2139. The PmanP promoter, when induced by mannose, increases the beta-galactosidase activity of bacteria, which thus increases the expression of lacZ by four to seven-fold. In this experiment, we are using a 0.2% concentration of mannose in order to test the induction of transcription. false false _578_ 33889 33889 9 false During the design it was found that several derivatives of the PmanP promoter did not induce beta-galactosidase, it was then decided to cut out those derivatives in order to use a sequence that induced beta-galactosidase while staying under the 60 base pair maximum requirement. false Emilie Uffman annotation2482704 1 -10 box range2482704 1 39 43 annotation2482705 1 -35 box range2482705 1 15 20 BBa_J100303_sequence 1 tatagggaaaaatgattttaatgagctgatttcggtatacagttgagaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z