BBa_J100305 1 BBa_J100305 upp Promoter 2016-09-07T11:00:00Z 2016-10-06T04:00:35Z This promoter came from E. Coli and this journal article, "Regulation of upp Expression in Escherichia coli by UTP Sensitive Selection of Transcriptional Start Sites Coupled with UTP-Dependent Reiterative Transcription" by ANH-HUE THI TU AND CHARLES L. TURNBOUGH, JR. in the Journal of Bacteriology. We got this sequence from the given information about the UPP gene sequence promoter in this article and online at this web resource: http://margalit.huji.ac.il/promec/prom.seq.final.html. This promoter is UTP sensitive and begins the transcription process of the upp gene in E. coli. We are going to test with a 600 μM solution of UTP. false false _578_ 201 33909 9 false None false Sabrina Shepherd annotation2482703 1 -35 box range2482703 1 24 29 annotation2482702 1 -10 box range2482702 1 46 51 BBa_J100305_sequence 1 gactaaagtcaacgaaaagaatattgccgccttgaagaaaggaggtataatccgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z