BBa_J100311 1 BBa_J100311 Scrambled TetR repressible promoter 2016-12-02T12:00:00Z 2016-12-03T01:43:32Z The original sequence is the TetR repressible promoter, R0040. Binding regions were identified from Orth P, et al., "Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system." DOI: 10.1038/73324 We scrambled the TetR binding regions of the TetR repressible promoter (R0040). The scrambled promoter is not functional, whether or not aTc is present to free the binding sites. We will use it as a negative control when using repClone (J100205) to test the effects of modifications to the promoter. false false _578_ 18858 18858 9 false We were cautious to scramble only those bases involved in TetR binding, while keeping other bases the same in order to maintain as best we can the spacing and structure of the original promoter. false Monica Prudencio annotation2531664 1 5' TetR binding site range2531664 1 4 16 annotation2531665 1 3' TetR binding site range2531665 1 29 41 BBa_J100311_sequence 1 tcctgttatcacgaagagattgacatccagtgttatacagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z