BBa_J100313 1 BBa_J100313 Scrambled OmpR Partial Promoter (first 70 bp) 2017-01-19T12:00:00Z 2017-01-19T09:53:08Z The original sequence is the OmpR promoter (R0082). We used an online scrambling tool to generate the new sequence (http://www.bioinformatics.org/sms2/shuffle_dna.html). We scrambled the first 70 base pairs of the OmpR promoter (R0082). This should disrupt the transcription factor binding sites such that the promoter is no longer functional. We will insert this modified promoter in actClone (J100204) to serve as a negative control when testing the effects of modifications to the promoter. false false _578_ 18858 18858 9 Not in stock false N/A false Monica Prudencio annotation2532805 1 Location of wt C3 OmpR range2532805 1 54 70 annotation2532804 1 Location of wt C2 OmpR range2532804 1 34 51 annotation2532803 1 Location of wt C1 OmpR range2532803 1 13 30 BBa_J100313_sequence 1 tttttactactaataatactcatgatataatactagtacagcttagtttcgccagaatactagttagtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z