BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J11030 1 B_whiteboa Bacterial Whiteboard by Hannah 2005-10-02T11:00:00Z 2015-08-31T04:08:25Z When lactose is added to the system, bind to lac repressor (endogenous) therefore GFP produced - glow green. When Tet added to the system, drive transcription of lacZ beta galactosidase which hydrolyses latose and lac repressor active. Stop Glowing green. ***NOTE*** This system will ONLY WORK IN LAC Z- bugs!!!!! false false _38_ 0 323 38 Not in stock false false Seema Nagaraj component2227265 1 BBa_E0040 component2227262 1 BBa_B0030 component2227230 1 BBa_R0040 component2227255 1 BBa_I2012 component2227266 1 BBa_B0012 component2227256 1 BBa_R0011 annotation2227256 1 BBa_R0011 range2227256 1 579 632 annotation2227266 1 BBa_B0012 range2227266 1 1391 1431 annotation2227255 1 BBa_I2012 range2227255 1 63 570 annotation2227262 1 BBa_B0030 range2227262 1 642 656 annotation2227265 1 BBa_E0040 range2227265 1 663 1382 annotation2227230 1 BBa_R0040 range2227230 1 1 54 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation2000 1 -35 range2000 1 20 25 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_I2012 1 BBa_I2012 Reporter Device (B0034.E0033.B0015) 2004-01-27T12:00:00Z 2015-08-31T04:07:39Z RBS, LacZ coding region, terminator reporter device that makes a relatively stable blue product false true _1_ 0 24 7 It's complicated false false Alvin Carter Powers, Yong-Su Jin (Fighting Darwins) component2220139 1 BBa_B0015 component2220132 1 BBa_E0033 component2220121 1 BBa_B0034 annotation2220139 1 BBa_B0015 range2220139 1 380 508 annotation2220132 1 BBa_E0033 range2220132 1 19 371 annotation2220121 1 BBa_B0034 range2220121 1 1 12 BBa_E0033 1 lacZ a LacZ alpha fragment; complements matching N-terminal deletion mutant (lacZ-omega) 2004-01-27T12:00:00Z 2015-08-31T04:07:25Z www.ncbi.nlm.nih.gov to greatly reduce the number of bases, this is only a portion of the LacZ gene false false _1_ 0 24 7 In stock false Restriction sites (modified) <br/>76-79 (gcc to gca) 79-81 (gct to gca) 85-87 (gaa to gag) 106-108 (tgc to tgt) 109-111(agg to aga) true Yong-Su Jin (Fighting Darwins) annotation1938940 1 T7 promoter range1938940 1 173 191 annotation308387 1 C range308387 1 78 78 annotation308388 1 G range308388 1 111 111 annotation1938939 1 T3 promoter range1938939 1 26 35 annotation308375 1 T range308375 1 81 81 annotation308383 1 C range308383 1 108 108 annotation308381 1 A range308381 1 87 87 annotation308320 1 lacZ alpha range308320 1 1 348 annotation1938941 1 lacZ gene fragment range1938941 1 199 348 annotation1938942 1 lacZ gene fragment range1938942 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E0033_sequence 1 atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_I2012_sequence 1 aaagaggagaaatactagatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J11030_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z