BBa_J119001 1 BBa_J119001 BsmBI-RBS-GFP1-BsaI 2011-07-20T11:00:00Z 2015-08-31T04:08:26Z PCR Amplification of the GFP template split with specific oligos to result in the full noted 407 nt sequence. First half of the full GFP gene for solving of HPP (Hamiltonian Path Problem) with multiple nodes. Works in conjunction with BBa_J119002 as second half of split GFP gene. The half edge noted below in the first 58nt of GFP-1/2 is intended to be annealed back to GFP-2/2 by JM109 causing green fluorescence. It is also intended to be mixed with other gene halves to attempt a multi-node HPP problem that will show correct completion if all reporters are present (resistance, fluorescence, etc.). All groupings must have both halves of a specific reporter gene to function properly. GFP_1_For (58mer) GCAT GAATTC CGTCTC A GTGG CA AAAGAGGAGAAA CGTACGAC ATGCGTAAAGGAGAA 4nt EcoRI BsmBI a 1234 nn RBS 0034 8nt 5mer of GFP1 (?? edge) GFP_1_Rev (36mer) ATGC CTGCAG GGTCTC A GGGT ATCACCTTCAAACTT 4 PstI BsaI a 1234 15mer of GFP_1 reverse (Gene 1234 RC) false false _613_ 0 10385 9 Not in stock false This is not a BioBrick part. It was designed and produced for the specific purpose of solving multi-node Hamiltonian Path Problems with the computing power of E Coli. false Caleb J. Carr BBa_J119001_sequence 1 gaattccgtctcagtggcaaaagaggagaaacgtacgacatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgataccctgagaccctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z