BBa_J119005 1 BBa_J119005 BsmBI-RBS-RFP1-BsaI 2011-07-20T11:00:00Z 2015-08-31T04:08:26Z PCR Amplification of the RFP gene template. This is RFP-1, the first half of the RFP Gene Template to be used in conjunction with RFP-2 (J119006) to act as a node for solving Hamiltonian Path Problems (HPP). When successfully re-assembled will report with a red fluorescence that may be visible under normal light conditions. Can be used with other split genes to solve more complex HPP problems. RFP_1_For (58mer) 5??? GCAT GAATTC CGTCTC A GTGG CA AAAGAGGAGAAA CGTACGAC ATGGCTTCCTCCGAA3??? (4, EcoRI, BsmBI , a , Halfedge1234 , nn , RBS 0034 , 8 , 15mer of RFP) RFP_1_Rev (36mer) 5???ATGC CTGCAG GGTCTC A GCAG GGAGGAGTCCTGGGT 3??? (4, PstI , BsaI , a , Gene1234RC , 15mer of RFP reverse) false false _613_ 0 10385 9 Not in stock false It was quite difficult to synthesize this half-edge (first half of the gene to be used in solving a path problem). This is NOT a BioBrick Part, it has been produced for the purpose of putting together and solving HPP (Hamiltonian Path Problems) by adding its second half (and others) to competent cells for re-assembling. false Caleb J. Carr annotation2124129 1 EcoRI range2124129 1 1 6 BBa_J119005_sequence 1 gaattccgtctcagtggcaaaagaggagaaacgtacgacatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgctgagaccctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z