BBa_J119006 1 BBa_J119006 BsaI-RFP2-BsmBI 2011-07-20T11:00:00Z 2015-08-31T04:08:26Z PCR amplification of the RFP gene template. This is RFP-2, the second half of the RFP Gene Template to be used in conjunction with RFP-1 (J119005) to act as a node for solving Hamiltonian Path Problems (HPP). When successfully re-assembled will report with a red fluorescence that may be visible under normal light conditions. Can be used with other split genes to solve more complex HPP problems. RFP_2_For (36mer) 5??? GCAT GAATTC GGTCTC A CTGC AAGACGGTGAGTTCA 3??? (4, EcoRI , BsaI, a , Gene1234 , 15mer of RFP) RFP_2_Rev (75mer) 5???ATGC CTGCAG CGTCTC A CCAC GCTAGCACTGTACCTAGGACTGAGCTAGCCGTCAA TTGC TTATTAAGCACCGGT 3??? (4, PstI , BsmBI , a , Halfedge1234RC , J23100 Reverse Complement , 4 , 15mer of RFP Rev) false false _613_ 0 10385 9 Not in stock false This is NOT a BioBrick Part, it has been produced for the purpose of putting together and solving HPP (Hamiltonian Path Problems) by adding its second half (and others) to competent cells for re-assembling. false Caleb J. Carr BBa_J119006_sequence 1 gaattcggtctcactgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataagcaattgacggctagctcagtcctaggtacagtgctagcgtggtgagacgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z