BBa_J119007 1 BBa_J119007 HPP Assembly Vector pSB1A2 with Promoter-BsmBI-BsaI 2011-07-21T11:00:00Z 2015-08-31T04:08:26Z Cloned from synthetic oligonucleotides into pSB1A2 EcoRI + PstI vector. Vector for use in Golden Gate Assembly of Hamiltonian Path Problem constructs. EcoRI site on the left. Then there is a J23100 promoter that points to the right. It is followed by a half-edge sticky word of GTGG, made available by a BsmBI site pointing to the left. Next is a BsaI site pointing to the right that frees up the following half-edge sticky word of GTGG. Finally, there is a PstI site. false false _613_ 0 606 61 Not in stock false Standard BioBrick prefix and suffix are not used. Only a EcoRI site is used as a prefix and a Pst I site as a suffix. false Todd Eckdahl BBa_J119007_sequence 1 gaattcttgacggctagctcagtcctaggtacagtgctagcgtggtgagacggccgggtctcagtggctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z