BBa_J119011 1 BBa_J119011 BsaI-GFP2 (BsaI removed)-BsmBI 2011-08-02T11:00:00Z 2015-08-31T04:08:26Z PCR Amplification of existing part: GFP (E0040)split 351 bp from the beginning of the gene at with the sticky word ACCC This is GFP-2A, the second half of the GFP Gene Template to be used in conjunction with RFP-1 (J119005) to act as a node for solving Hamiltonian Path Problems (HPP). When successfully re-assembled will report with a red fluorescence that may be visible under normal light conditions. Can be used with other split genes to solve more complex HPP problems. false false _613_ 0 10447 9 Not in stock false This is NOT a BioBrick compatible part. It was designed to solve Hamiltonian Path Problems using multiple genes. There is a rogue BsaI site at position 304 causing 457 bp to split into 304 bp and 153 bp. It can be removed or altered to lessen the occurrence of additional cutting at that site. false Zachary Caton annotation2124261 1 BsaI range2124261 1 7 13 annotation2124264 1 Sticky Word: GCAA range2124264 1 383 386 annotation2124266 1 Sticky Word: GTGG range2124266 1 441 444 annotation2124265 1 BsmBI range2124265 1 445 451 annotation2124262 1 EcoRI range2124262 1 2 6 annotation2124267 1 PstI range2124267 1 452 457 annotation2124260 1 Sticky Word: ACCC range2124260 1 14 17 annotation2124263 1 Rogue BsaI site range2124263 1 305 311 BBa_J119011_sequence 1 gaattcggtctcaacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagatcacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataagcaatccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgtggtgagacgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z