BBa_J119013 1 BBa_J119013 FINISH 2011-08-17T11:00:00Z 2015-08-31T04:08:26Z Oligo constructs designed for the purpose of solving Hamiltonian Path graphs. Finish half edge for use in Golden Gate Assembly of Hamiltonian Path Problem constructs. BsmBI site pointing right that when digested frees up half edge word "GTGG" on the 5' end that allows ligation to any gene 2 half-edge. Followed by the BsaI site pointing left that when digested frees up the FINISH word "CGAG" that allows ligation to the new tr5f4HPP vector. In between these two sites is an 8 nt spacer. This section is flanked by EcoRI and PstI sticky ends for cloning. false false _613_ 0 10385 9 Not in stock false Half-edge words must match the half edge words exactly that you want to ligate to. false Caleb J. Carr annotation2125445 1 8 NT Spacer range2125445 1 17 24 annotation2125443 1 EcoRI range2125443 1 1 6 annotation2125446 1 Finish Word range2125446 1 25 28 annotation2125444 1 BsmBI range2125444 1 7 12 annotation2125449 1 PstI range2125449 1 35 40 annotation2125448 1 BsaI range2125448 1 29 34 annotation2125447 1 Half-Edge Word range2125447 1 13 16 BBa_J119013_sequence 1 aattccgtctcagtgggcatcagtcgagagagaccctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z